Iron homeostasis
Despite the usually high abundance of Fe in soils, low solubility of Fe-bearing minerals restricts the available Fe pools in most aerobic soils to levels which are far below those required for plant growth. To acquire the necessary amounts of Fe from the environment, plants have evolved mechanisms to make Fe more available for uptake
. 

In roots of Fe-deficient plants, enhanced activity of proton transporting ATPases in the plasma membrane helps to increase the solubility of Fe hydroxide species and provides a slightly acidic pH in the apoplast that restricts the electrostatic repulsion of negatively charged Fe(III) chelates. In addition, the action of the H+-ATPase ensures an optimal pH for the activity of a plasma membrane-bound Fe(III) chelate reductase (FRO2) which transfers electrons from intracellular pyridine nucleotides to extracellular Fe(III). Fe(III) chelate reductase activity is co-regulated with an iron-regulated transporter (IRT1) displaying increased expression under iron-limited conditions. 
 

Immunocytolocalization of P-type H+-ATPase in rhizodermal cells of tomato roots

Further responses to Fe starvation are concerned with alterations in root morphology and root architecture, often leading to an increase in the absorptive surface area. Depending on the species, such an increase can be achieved by the formation of extra root hairs, development of clusters of secondary lateral roots (proteoid roots), or the formation of transfer cells in the rhizodermis. 
 

Fe stress-induced cluster roots of Lupinus albus

We are taking a combined physiological, molecular, and structural approach toward understanding the control of the adaptive responses to iron deficiency stress. This approach involves the physiological characterization and determination of enzymes involved in iron uptake at the protein and mRNA level, elucidation of short and long distance signaling pathways, analysis of iron-induced changes in root morphology, and introduction of iron-responsive genes in plants. 

‘On grid’ in situ hybridization of LeIRT1 in epidermal cells of tomato roots
tacatcgcca ttttcctcct tctcatctca attttggccc ctcgagtact atcagtagta gaagattgtg gagcagaagaagacaactca tgtgtcaata 

Special emphasis is given on the induction and function of transfer cells, parenchymatous cells with conspicuous ingrowths of secondary wall material that protrude into the cell lumina and increase the area to volume ratio. Similar to root hairs, transfer cells can be induced by auxin and ethylene, but in contrast to the development of root hairs the formation of transfer cells is not dependent on the ethylene and auxin signalling cascades. Thus, their formation appears to be controlled by a separate pathway. 
 

Formation of rhizodermal transfer cells in Fe-deficient Lycopersicon esculentum roots

Co-operations
Prof. T. Buckhout
Dr. F. Dunemann